Помощничек
Главная | Обратная связь


Археология
Архитектура
Астрономия
Аудит
Биология
Ботаника
Бухгалтерский учёт
Войное дело
Генетика
География
Геология
Дизайн
Искусство
История
Кино
Кулинария
Культура
Литература
Математика
Медицина
Металлургия
Мифология
Музыка
Психология
Религия
Спорт
Строительство
Техника
Транспорт
Туризм
Усадьба
Физика
Фотография
Химия
Экология
Электричество
Электроника
Энергетика

Области начала репликации (ОНР) ARS и комплекс узнавания ОНР (ORC)



У S. cerevisiae были идентифицированы специфические элементы хромосомной ДНК, названные автономно реплицирующимися последовательностями ARS (autonomously replicating sequences). Встраивание этих элементов в кольцевые плазмидные ДНК обеспечивает автономную репликацию плазмид в клетках дрожжей. С использованием метода двумерного гель-электрофореза, позволяющего обнаружить репликативные пузырьки ДНК, было показано, что элементы ARS совпадают с сайтами начала двунаправленной репликации ДНК как в содержащих ARS плазмидах, так и в самих дрожжевых хромосомах. Таким образом, последовательности ARS являются функциональными ОНР хромосомной ДНК S. cerevisiae. Эти свойства дрожжевых ОНР значительно облегчили их изучение.

В 16 хромосомах S. cerevisiae содержатся от 250 до 400 ОНР. Все изученные элементы ARS у дрожжей, имеющие модульную структуру, состоят из доменов А и В и имеют длину 100-150 п.н. (рис. 3.5). Домен А содержит консенсусную последовательность, названную ACS (ARS consensus sequence). Элемент ACS длиной 11 п.н. имеет первичную последовательность (A/T)TTTA(T/C)(A/G)TTT(A/T), являющуюся существенной для инициации репликации. Даже одиночные замены нуклеотидов в ACS могут устранить активность ARS. Тем не менее, некоторые известные ARS, содержащие одну и даже две измененные пары нуклеотидов по сравнению с ACS, являются эффективными ОНР. С другой стороны, не каждая последовательность ACS в геноме проявляет активность ОНР в отсутствие других доменов ARS.

Домен В в ARS состоит из 3 элементов. Ближайший к ACS элемент В1 образует вместе с ACS сайт связывания белкового комплекса узнавания ОНР. Богатый остатками А и Т элемент В2 выполняет функцию элемента расплетания ДНК DUE. Репликация ДНК в прототипной хромосомной ОНР ARS1 инициируется примерно посередине между сегментами В1 и В2. Элемент В3 в некоторых ARS связывает фактор транскрипции Abf1 и играет роль вспомогательного элемента AUX, обеспечивающего оптимальную эффективность инициации репликации. Элементы доменов В в различных элементах ARS у дрожжей гораздо менеее консервативны, чем домен А. Наиболее консервативным из них является элемент В1.

В прототипный элемент ARS1 иногда включают и третий домен С, расположенный по другую сторону от ACS и упакованный в уникально позиционированную нуклеосому. Эта нуклеосома, вероятно, понижает вероятность упаковки смежного сайта ACS в другую нуклеосому, которая могла бы подавить активность ARS1.

C последовательностью ACS и смежным сегментом В1 в дрожжевых ARS на протяжении почти всего клеточного цикла связан белковый комплекс узнавания ori (ORC – origin recognition complex). Общее количество комплексов ORC в одной клетке примерно соответствует числу ARS. Этот комплекс состоит из 6 белков, кодируемых существенными генами ORC1-ORC6. Аналогичные комплексы ORC имеются у всех эукариотов (табл. 4.1). Три субъединицы комплекса (Orc1, Orc4 и Orc5) содержат сайты связывания нуклеотидов, как у ДНК-зависимых АТФаз, и относятся к семейству АТФаз ААА+. Самая большая субъединица Orc1 может гидролизовать АТФ in vitro, но в присутствии ДНК ARS гидролиз АТФ предотвращается. По-видимому, как и в случае белка DnaA, связанный АТФ играет в ORC роль аллостерического эффектора, требующегося для специфической ассоциации с последовательностями ДНК ARS, а гидролиз АТФ идет на более поздних стадиях инициации репликации.

 

AAATTTCGAAAAATGCT AAGAAATAGGTTAGTACTGAGTAGT

B3

 
 

ATTTATTTAAGTATT GTTTGTGCACTTGCCTG CAAGGGCCTTTT

B2

GAAAAGCAAGCAT AAAAGATC TAAACATAAAA TCTGTAAAATAACA

B1 ACS




©2015 studopedya.ru Все права принадлежат авторам размещенных материалов.